metQ [2018-05-30 12:50:53]

methionine ABC transporter (binding lipoprotein)

Locus: BSU32730

Isoelectric point: 8.49

Molecular weight: 30.20 kDa

Protein length: 274 aa

Gene length: 822 bp

Function: methionine uptake

Product: methionine ABC transporter (binding lipoprotein)

Essential: no

Synonyms: yusA

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of amino acids
• Metabolism → Amino acid/ nitrogen metabolism → Biosynthesis/ acquisition of amino acids → Biosynthesis/ acquisition of methionine/ S-adenosylmethionine
• Groups of genes → Secreted proteins
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,361,767 → 3,362,591

The protein

Paralogous protein(s)

• YhcJ

Structure

• 4GOT

Localization

• associated to the cell membrane, via MetP PubMed
• extracellular (signal peptide) PubMed, lipid modification as retention signal

Expression and Regulation

Operons

• Genes: metN-metP-metQ
  Description: PubMed

  Regulatory mechanism

  • S-box: transcription termination/ antitermination, the S-box riboswitch binds S-adenosylmethionine resulting in termination, in S-box
  • CodY: activation, PubMed, in CodY regulon

  Regulation

  • activated during growth in the presence of branched chain amino acids (CodY) PubMed
  • the mRNA is processed between metP and metQ by RNase Y, this requires the YmcA-YlbF-YaaT complex PubMed
  • the S-box RNA is degraded by RNase Y PubMed

Biological materials

Mutant

• MGNA-A595 (yusA::erm), available at the NBRP B. subtilis, Japan
• BKE32730 (ΔmetQ::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TAGCTTTTTCAATGTAAATC, downstream forward: _UP4_TAAGACTGAAACCCCGGATG
• BKK32730 (ΔmetQ::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TAGCTTTTTCAATGTAAATC, downstream forward: _UP4_TAAGACTGAAACCCCGGATG

References

Loading